circad | circRNAs associated with diseases

hsa_circ_0023956
Gene	C11orf73	Organism	Human
Genome Locus	chr11:86017286-86017524:+	Build	hg19
Disease	Active Pulmonary Tuberculosis	ICD-10	Respiratory tuberculosis, bacteriologically and histologically confirmed (A15-A19)
DBLink	Link to database	PMID	28846924
Experimental Method
Sample Type	Peripheral Blood Mononuclear Cells (PBMCs)	Comparison	Peripheral Blood Mononuclear Cells (PBMCs) from Active Pulmonary Tuberculosis (APTB) (n=10) and Controls (n=10)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAATGGGAGGATCTGTCTAC Reverse TTATCCTCTGCCACTTGCT	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Zhuang, ZG, Zhang, JA, Luo, HL, Liu, GB, Lu, YB, Ge, NH, Zheng, BY, Li, RX, Chen, C, Wang, X, Liu, YQ, Liu, FH, Zhou, Y, Cai, XZ, Chen, ZW, Xu, JF (2017). The circular RNA of peripheral blood mononuclear cells: Hsa_circ_0005836 as a new diagnostic biomarker and therapeutic target of active pulmonary tuberculosis. Mol. Immunol., 90:264-272.